Bir programcı gözüyle DNA

0
tongucyumruk
"Eğer bir çekiçseniz, herşey bir çivi gibi gözükecektir".

Sanıyorum özellikle bu siteyi takip eden programcıların çoğu en az bir kez biyolojik yapılarla bilgisayarlar arasında bir bağlantı kurmaya çalışmıştır. Bu site DNA'dan başlayıp proteinlere uzanarak bilgisayar kavramları ile bu kavramların biyolojik karşılıkları konusunda oldukça detaylı bir inceleme içeriyor. Eğer kendini 4'lük sistemde (T, G, C, A) çalışan bir robot olarak ifade edenlerdenseniz bir uğramanızda fayda var.

Görüşler

0
FZ
Ben DNA mekanizmasını ve yol açtıklarını bir bilgisayar programına değil de daha çok GO oyununa benzetiyorum. Ya da tam tersi ;-)
0
malkocoglu
Shibumi'yi okudunuz galiba...
0
FZ
Allah seni inandırsın GO oyunu ile tanışıklığım SHIBUMI isimli kitabı okumamdan çok daha öncesine dayanıyor ve yani kişisel olarak alma ama bu soru ile 1500. kez karşılaşmak ruhumda kaotik fırtınalara yol açıyor :-P

Ne kitapmış yahu :) Bilmem kaç bin yıllık oyun için halkla ilişkiler kampanyası görevi gördü, kimsenin yapamadığını yaptı :)
0
FZ
Söz kitaplardan açılmışken GO bağlamında okuduğum en güzel romanlardan biri olan GO USTASI adlı kitabı tavsiye ederim.
0
polat
bir de dna kodlarini kullanarak mesaj yazma olayi var dna-o-gram diye..

gctaagaaaacaatgaaggtaatgaccatgaacaaggcaagcacg
0
anonim
Yakın bi gelecekte hdd'lerin yaptığı işi dna'lar üstlenebilir.
0
FZ
Bir de Adleman isimli üstad var, bizzat biyoloji laboratuvarındaki çözeltilerde barındırdığı genlerle optimizasyon problemlerini falan çözen. Kendisi meşhur (açık anahtar şifreleme algoriması) RSA´daki ´A´ oluyor ;-) Ya da DNA´nın A´sı mı deseydim? Yoksa ADENIN´in A´sı mı? :)
Görüş belirtmek için giriş yapın...

İlgili Yazılar

Looking Glass 3D LiveCD

halixus

Looking Glass 3D LiveCD 2.3a yayinlandi. Looking Glass 3D yi kuramayanlar, kurupta çalıştıramayanlar düşünülerek hazırlanmış. Slax tabanlı bir Live3d yaklaşık olarak 250MB boyutunda. LG3D nedir nasıl bir şeydir diye merak edenler için iso dosyası indirilmeye hazır. Minimum 2GHz işlemci ve 512MB RAM ile çalıştırmanız önerilmekte. Daha önceki sürümündeki hatalar giderilmiş. En azından çalışabilir bir sürüm olmuş.Pencereleri 360 derece döndürmek, yakınlaştırıp uzaklaştırmak oldukça eğlenceli. Bu sürümünde gaim ve firefox la birlikte geliyor. Ekran görüntüleri ise burada.

PC Sistemlerinde Bellek Miktarının Bulunması

FZ

Daha önce Linux sistemlerde bellek yönetimi başlangıcına dair uzun ve detaylı bir makalesi ile tanıdığımız Bora Şahin'in PC Sistemlerinde Bellek Miktarının Bulunması başlıklı makale meraklı `hacker´ların hizmetine sunulmuştur.

Editörün Notu: Birkaç saat sonra askere gideceğine dair haberini aldığım Bora Şahin arkadaşımızın askerliğinin olabildiğince sorunsuz geçmesini diliyorum. Umarım bir an önce aramıza döner ve yazdığı makalelerle bizleri aydınlatmaya devam eder.

Dil Hatası Yapanları Engerek 0.1 Isırıyor Dikkatli Olun!

FZ

Ali Alphan Bayazıt'ın duyurduğuna göre özgür Türkçe yazım denetçisi engerek, Debian GNU/Linux paketiyle beraber piyasaya çıktı. Bu sürüm, muhtemel gelecek sürümler gibi Zemberek kütüphanesinin gcj dostu bir çeşidini kullanıyor.

Kurulum detaylarını buradan öğrenmek mümkün. Alphan Bayazıt, engerek sistemini Emacs, Kate, Kedit, KOffice ve Konqueror ile denediğini, sonuçtan memnun kaldığını belirtiyor.

Kendisine teşekkür ediyor ve yazılımını acımasızca test edip hata raporuna boğmak için hep birlikte kolları sıvıyoruz (yapıyoruz değil mi? ;-)

Flash 10 son beta versiyonu (Astro) yeni linux özellikleriyle birlikte çıktı

ersin2k

Geçtiğimiz ay Adobe Flash Player in 10ncu sürümü Windows yanında Mac OS X ve Linux için aynı anda yayınlandı. Bu beta sürümü yeni 3D efektler, geliştirilmiş metin düzeni, geliştirimiş API ve görsel performans güçlendirmeleri eklemişti. Bugün Adobe Flash player 10 için yeni bir beta daha çıkarttı.ASTRO adlı bu versiyonda linux için penceresiz "wmode" , web kameraları için Video4Linux 2 (V4L2) desteği, yeni dil desteği (Türkçe artık var), arttırılmış hız ve güçlendirilmiş stabilite sunuyor. Ancak henüz 64 bit versiyonu yok.

4`üncü Fonksiyonel Programcılar Konferasyonu

anonim

4`üncü Fonksiyonel Programcılar Konferasyonu 3-5 Eylül tarihlerinde Floransa'da başlıyor, Türk yazılımcıları da oralarda görmek isteriz, umarım katılan olur. Detaylı bilgi için: http://cristal.inria.fr/ICFP2001/prog-contest/
(Editörün notu: ICPF, International Conference on Functional Programming 2001 bünyesinde bir de programlama yarışması var.)