Bir programcı gözüyle DNA

0
tongucyumruk
"Eğer bir çekiçseniz, herşey bir çivi gibi gözükecektir".

Sanıyorum özellikle bu siteyi takip eden programcıların çoğu en az bir kez biyolojik yapılarla bilgisayarlar arasında bir bağlantı kurmaya çalışmıştır. Bu site DNA'dan başlayıp proteinlere uzanarak bilgisayar kavramları ile bu kavramların biyolojik karşılıkları konusunda oldukça detaylı bir inceleme içeriyor. Eğer kendini 4'lük sistemde (T, G, C, A) çalışan bir robot olarak ifade edenlerdenseniz bir uğramanızda fayda var.

Görüşler

0
FZ
Ben DNA mekanizmasını ve yol açtıklarını bir bilgisayar programına değil de daha çok GO oyununa benzetiyorum. Ya da tam tersi ;-)
0
malkocoglu
Shibumi'yi okudunuz galiba...
0
FZ
Allah seni inandırsın GO oyunu ile tanışıklığım SHIBUMI isimli kitabı okumamdan çok daha öncesine dayanıyor ve yani kişisel olarak alma ama bu soru ile 1500. kez karşılaşmak ruhumda kaotik fırtınalara yol açıyor :-P

Ne kitapmış yahu :) Bilmem kaç bin yıllık oyun için halkla ilişkiler kampanyası görevi gördü, kimsenin yapamadığını yaptı :)
0
FZ
Söz kitaplardan açılmışken GO bağlamında okuduğum en güzel romanlardan biri olan GO USTASI adlı kitabı tavsiye ederim.
0
polat
bir de dna kodlarini kullanarak mesaj yazma olayi var dna-o-gram diye..

gctaagaaaacaatgaaggtaatgaccatgaacaaggcaagcacg
0
anonim
Yakın bi gelecekte hdd'lerin yaptığı işi dna'lar üstlenebilir.
0
FZ
Bir de Adleman isimli üstad var, bizzat biyoloji laboratuvarındaki çözeltilerde barındırdığı genlerle optimizasyon problemlerini falan çözen. Kendisi meşhur (açık anahtar şifreleme algoriması) RSA´daki ´A´ oluyor ;-) Ya da DNA´nın A´sı mı deseydim? Yoksa ADENIN´in A´sı mı? :)
Görüş belirtmek için giriş yapın...

İlgili Yazılar

Veritabanı Teknolojilerindeki Yenilikler

FZ

Veritabanı ve bununla bağlantılı çözümler deyince son 20-25 yıldır çoğunluğun aklına gelen terimler aynıdır : SQL, ilişkisel veritabanı yönetim sistemi (markadan bağımsız), ODBC ve bunlara C++, Visual Basic, JAVA gibi dillerle erişmek ve sonuç çözümü programlamak.

Markalar değişir, işletim sistemleri değişir, işin içine Internet girer, sistemler biraz daha hızlanır, fiyatlar değişir ama temelde öyle radikal değişiklikler olmaz... diye düşünüyordum ben bugüne kadar ancak bu düşüncemi değiştiren birkaç şirketin web sayfalarına göz atıp bir miktar inceleme yaptıktan sonra öğrendiklerimi sizinle paylaşmaya karar verdim.

GUI Tarihçesi

FZ

Windows 1.0 neye benziyordu? Peki ya Apple II'yi gören oldu mu? OS/2 V 1.1 ? Hmm peki ya Perq diye bir iş istasyonu duydunuz mu, grafik arabirimini gördünüz mü? 1968'de ilk demosu yapılan 'mouse' ne menem bir aletti? Bugün kullandıklarımıza ne kadar benziyordu? Acaba Xerox Alto sistemini ve Elixir Masaüstünü kullanmak (en azından görsel olarak) nasıl bir duyguydu?

MultiServis Türkçe Web Server Paketi Piyasada!

anonim

MultiServis Türkçe Web Server Paketi Kullanıma Sunuldu!

MultiServis Türkçe Web Server 'NuSphere® MySQLTM',
Başlarken ürünü web uygulamaları yapmak için yeni teknoloji ile geliştirilmiş, güvenilir ve maliyetsiz bir MySQL, Apache web server, PHP ve Perl tümleştirilmiş yazılım ailesinin birleşik halidir.

YZC Sözlük v0.0.6 Çıktı

anonim

YZC Sözlük, GNU/Linux için GPL lisanslı sözlük uygulamamız 0.0.6 sürümüne ulaşmıştır.

Bu sürümdeki en önemli özellik, programa dahil edilen sınavcı ve -- festival ses sentezleme programını kullanılarak -- kelime seslendirme özelliğidir.

Sözlüğe kaynak kodları ile http://www.yzcsozluk.info adresinden ulaşabilirsiniz.

Yazılım temalı Türkçe soru/cevap kardeşliğine davet

coskung

Yazılım dünyasında olup da Stackoverflow’u (SO) bilmeyen yoktur. Yazılım konusunda Google’da yapacağınız her aramada mutlaka SO’dan birkaç sonuç çıkacaktır. SO, yaklaşık 3.3 milyon soru, 6.6 milyon cevap ve 1.2 milyon kullanıcıya sahip devasa bir soru cevap sitesi. Şu anda dünyadaki tüm yazılımcıların itibar ettiği en önemli bilgi merkezlerinden birisi. Günde 4 milyondan fazla ziyaretçi çekiyor. SO, yalnız başına bir site değil, kocaman bir ağın en popüler parçası. Stackexchange (SX) ağı, aşçılıktan fiziğe, elektronikten bisiklete farklı birçok konuda soru/cevap sitesine sahip.