Bir programcı gözüyle DNA

0
tongucyumruk
"Eğer bir çekiçseniz, herşey bir çivi gibi gözükecektir".

Sanıyorum özellikle bu siteyi takip eden programcıların çoğu en az bir kez biyolojik yapılarla bilgisayarlar arasında bir bağlantı kurmaya çalışmıştır. Bu site DNA'dan başlayıp proteinlere uzanarak bilgisayar kavramları ile bu kavramların biyolojik karşılıkları konusunda oldukça detaylı bir inceleme içeriyor. Eğer kendini 4'lük sistemde (T, G, C, A) çalışan bir robot olarak ifade edenlerdenseniz bir uğramanızda fayda var.

Görüşler

0
FZ
Ben DNA mekanizmasını ve yol açtıklarını bir bilgisayar programına değil de daha çok GO oyununa benzetiyorum. Ya da tam tersi ;-)
0
malkocoglu
Shibumi'yi okudunuz galiba...
0
FZ
Allah seni inandırsın GO oyunu ile tanışıklığım SHIBUMI isimli kitabı okumamdan çok daha öncesine dayanıyor ve yani kişisel olarak alma ama bu soru ile 1500. kez karşılaşmak ruhumda kaotik fırtınalara yol açıyor :-P

Ne kitapmış yahu :) Bilmem kaç bin yıllık oyun için halkla ilişkiler kampanyası görevi gördü, kimsenin yapamadığını yaptı :)
0
FZ
Söz kitaplardan açılmışken GO bağlamında okuduğum en güzel romanlardan biri olan GO USTASI adlı kitabı tavsiye ederim.
0
polat
bir de dna kodlarini kullanarak mesaj yazma olayi var dna-o-gram diye..

gctaagaaaacaatgaaggtaatgaccatgaacaaggcaagcacg
0
anonim
Yakın bi gelecekte hdd'lerin yaptığı işi dna'lar üstlenebilir.
0
FZ
Bir de Adleman isimli üstad var, bizzat biyoloji laboratuvarındaki çözeltilerde barındırdığı genlerle optimizasyon problemlerini falan çözen. Kendisi meşhur (açık anahtar şifreleme algoriması) RSA´daki ´A´ oluyor ;-) Ya da DNA´nın A´sı mı deseydim? Yoksa ADENIN´in A´sı mı? :)
Görüş belirtmek için giriş yapın...

İlgili Yazılar

İşte geleceğin bilgisayarının arayüzü

nehuse

Sun'ın bilgisayar masaüstü ortamı kavramında devrim yaratacak bu yeniliği henüz geliştirme aşamasında.

Bu yeni kavram, iki boyutlu olarak kullandığımız masaüstünün yerine, üç boyutlu, içinde dolaşabildiğimiz, simgelerimizi, pencerelerimizi, nesnelerimizi yerleştirebildiğimiz sanal bir ortam sunuyor.

"Looking Glass" adı verilen bu projenin yalnız Linux sistemler üzerinde çalışan prototipi mevcut. 2004 yılı ortalarında ilk beta sürümün çıkması planlanıyor.

Sun LGP sayfası:
http://wwws.sun.com/software/looking_glass/index.html

Basın toplantısının videosu: (quickTime)
http://webcast-east.sun.com/archives/GSN-1312/GSN-1312_forjds.mov

Whitespace; Tertemiz bir Dil !

anonim

Eğer sizde her öğrendiğiniz dilde acayip karakterleri ezberlemekten bıktıysanız buyrun Whitespace'e. Bir takım über geek şahsiyetler tarafından yazılmış bu programlama dilinde bütün kodlama [Space] , [Tab] ve [LF] ile yapılıyor. Bu dil ile birşeyler yazmayı düşünecek kadar aştığınızı düşünüyorsanız sizi böyle alalım...

Windows için Opera 6.01 çıktı

anonim

Kullanımı hızlı bir tarayıcı olan Opera'nın Windows için 6.01 versiyonu çıktı.
Birkaç gün önce, 6.01 ismiyle Opera'nın ftp sitelerine konan ve çeşitli sitelerde duyurulan beta build ise, hatalar içerdiği için kullanılmamalı.
Resmi olarak duyurulan sürüm build 1041 ve Java'sız hali (ow32enen601.exe) 3.340.448 bayt büyüklüğünde. Yanlışlıkla sızan build de aynı isimi taşıdığından, indirdiğiniz dosyanın güncel olduğunu uzunluğuna bakarak anlayabilirsiniz. Veya doğrudan download sayfasını deneyin.

JavaScript 1.7

FZ

Şu anda Firefox 2 BETA içinde kullanılan ve JavaScript Shell içinden de test edilebilen JavaScript'in yeni sürümü olan JavaScript 1.7 programlama dili pek çok yeni ve güçlü özellikle birlikte geliyor.

Perl, Python ve Türk gençliğinin zihnini bulandırmak üzere hazırlanan global komplonun bir parçası olan ismi lazım değil bazı dillerin güçlü özelliklerini alan JavaScript 1.7 Internet programcılarının işlerini daha da kolaylaştıracağa ve JavaScript'in pazar payını artıracağa benziyor.

Trillian Astra

ercumend

Kullanıcılarının kendisininden vazgeçemediği Trillian uzun bir aradan sonra yeni sürümü Trillian Astra'nın alpha testlerine başladı. Arayüzü yenilenmiş Trillian Astra'nın performans ve kaynak tüketiminde de önemli iyileştirilmeler var. Ayrıca Trillian'ı cebinde taşımak veya herhangi bir yerden hesabına ulaşmak isteyen kullanıcılarda unutulmayarak bir web arayüzü düşünülmüş.