Bir programcı gözüyle DNA

0
tongucyumruk
"Eğer bir çekiçseniz, herşey bir çivi gibi gözükecektir".

Sanıyorum özellikle bu siteyi takip eden programcıların çoğu en az bir kez biyolojik yapılarla bilgisayarlar arasında bir bağlantı kurmaya çalışmıştır. Bu site DNA'dan başlayıp proteinlere uzanarak bilgisayar kavramları ile bu kavramların biyolojik karşılıkları konusunda oldukça detaylı bir inceleme içeriyor. Eğer kendini 4'lük sistemde (T, G, C, A) çalışan bir robot olarak ifade edenlerdenseniz bir uğramanızda fayda var.

Görüşler

0
FZ
Ben DNA mekanizmasını ve yol açtıklarını bir bilgisayar programına değil de daha çok GO oyununa benzetiyorum. Ya da tam tersi ;-)
0
malkocoglu
Shibumi'yi okudunuz galiba...
0
FZ
Allah seni inandırsın GO oyunu ile tanışıklığım SHIBUMI isimli kitabı okumamdan çok daha öncesine dayanıyor ve yani kişisel olarak alma ama bu soru ile 1500. kez karşılaşmak ruhumda kaotik fırtınalara yol açıyor :-P

Ne kitapmış yahu :) Bilmem kaç bin yıllık oyun için halkla ilişkiler kampanyası görevi gördü, kimsenin yapamadığını yaptı :)
0
FZ
Söz kitaplardan açılmışken GO bağlamında okuduğum en güzel romanlardan biri olan GO USTASI adlı kitabı tavsiye ederim.
0
polat
bir de dna kodlarini kullanarak mesaj yazma olayi var dna-o-gram diye..

gctaagaaaacaatgaaggtaatgaccatgaacaaggcaagcacg
0
anonim
Yakın bi gelecekte hdd'lerin yaptığı işi dna'lar üstlenebilir.
0
FZ
Bir de Adleman isimli üstad var, bizzat biyoloji laboratuvarındaki çözeltilerde barındırdığı genlerle optimizasyon problemlerini falan çözen. Kendisi meşhur (açık anahtar şifreleme algoriması) RSA´daki ´A´ oluyor ;-) Ya da DNA´nın A´sı mı deseydim? Yoksa ADENIN´in A´sı mı? :)
Görüş belirtmek için giriş yapın...

İlgili Yazılar

EVPL -->Türkçe Programlama Dili....

Debugger

Bir sabah kalkıp dünyayı değiştirebilir misiniz ? Bir programlama dili yazmaya soyunmaya, dahası paylaşmaya, paylaştırmaya ne dersiniz ?

\r\r \r\r Genç bir arkadaşımızın bu feryadı hakkında sözü olanlar eminim vardır. Umarım o da yaptığı işler hakkında bir URL verir bize ;) (Sundance)

Genç Yazılımcılara Abilik Yapacak

anonim

Hamdi Koçoğlu'nun, 1999 yılında kurduğu 'İzinternet' adlı firma, Anadolu'da internet üzerinden iş yapmak isteyen ve İngilizce içerik karşısında zorlanan firmalara hizmet veriyor. Şirket, Türkçe olarak geliştirip sattığı yazılımlarla Anadolu'da önemli bir pazar yakalamış durumda. 2004 yılında 2 milyon doları muhasebe yazılımından olmak üzere 5 milyon dolarlık satışa ulaşan İzinternet, şimdi de yazılım konusunda yeni bir yapılanmaya gidiyor.

Sanal Dükkan (E-Commerce)

tunc

Tarafımdan türkçeye çevirilen Linux altında php ve mysql desteğiyle çalışan başarılı bir E-Ticaret programı, şu an içerisinde "vpos" desteği içermemekle beraber, istenildiği zaman add-on yapılarak günümüzde "Vpos" hizmeti veren bankaların sistemleriyle entegre edilebilir. Aşağıdaki linkten demo olarak koyduğum sürümü görebilir ve test edebilirsiniz. Daha fazla bilgi için tunc@bilgidunyasi.com.tr ' a mail atabilirsiniz.
http://www.bilgidunyasi.com.tr/catalog/

Mobil Dünyanın Yeni İşletim Sistemi: Samsung BADA

cderici

Samsung yeni mobil işletim sistemi BADA ile seneye hızlı bir giriş yaptı. Geçen senenin sonlarına doğru ilk SDK'sı çıkan bu genç sistem, şimdilerde büyük kardeşleri Android ve iOS ile yarışır oldu. Peki nasıl oldu bu iş? Gelin birlikte bakalım..

Rakun XML Uygulama Platformu projesi 0.3.1 sürümünü çıkardı

evolution

İTÜ Yazılım Geliştirme Merkezi'nde 4 kişilik bir ekip tarafından yürütülen proje 0.3.1 sürümüne ulaştı. Web üzerinden uygulama tasarımı için tamamıyla XML kuralları kullanan platform arayüzler konusunda da kurumsal ihtiyaçları karşılayabilmek için AJAX yöntemini benimsemiştir.