Bir programcı gözüyle DNA

0
tongucyumruk
"Eğer bir çekiçseniz, herşey bir çivi gibi gözükecektir".

Sanıyorum özellikle bu siteyi takip eden programcıların çoğu en az bir kez biyolojik yapılarla bilgisayarlar arasında bir bağlantı kurmaya çalışmıştır. Bu site DNA'dan başlayıp proteinlere uzanarak bilgisayar kavramları ile bu kavramların biyolojik karşılıkları konusunda oldukça detaylı bir inceleme içeriyor. Eğer kendini 4'lük sistemde (T, G, C, A) çalışan bir robot olarak ifade edenlerdenseniz bir uğramanızda fayda var.

Görüşler

0
FZ
Ben DNA mekanizmasını ve yol açtıklarını bir bilgisayar programına değil de daha çok GO oyununa benzetiyorum. Ya da tam tersi ;-)
0
malkocoglu
Shibumi'yi okudunuz galiba...
0
FZ
Allah seni inandırsın GO oyunu ile tanışıklığım SHIBUMI isimli kitabı okumamdan çok daha öncesine dayanıyor ve yani kişisel olarak alma ama bu soru ile 1500. kez karşılaşmak ruhumda kaotik fırtınalara yol açıyor :-P

Ne kitapmış yahu :) Bilmem kaç bin yıllık oyun için halkla ilişkiler kampanyası görevi gördü, kimsenin yapamadığını yaptı :)
0
FZ
Söz kitaplardan açılmışken GO bağlamında okuduğum en güzel romanlardan biri olan GO USTASI adlı kitabı tavsiye ederim.
0
polat
bir de dna kodlarini kullanarak mesaj yazma olayi var dna-o-gram diye..

gctaagaaaacaatgaaggtaatgaccatgaacaaggcaagcacg
0
anonim
Yakın bi gelecekte hdd'lerin yaptığı işi dna'lar üstlenebilir.
0
FZ
Bir de Adleman isimli üstad var, bizzat biyoloji laboratuvarındaki çözeltilerde barındırdığı genlerle optimizasyon problemlerini falan çözen. Kendisi meşhur (açık anahtar şifreleme algoriması) RSA´daki ´A´ oluyor ;-) Ya da DNA´nın A´sı mı deseydim? Yoksa ADENIN´in A´sı mı? :)
Görüş belirtmek için giriş yapın...

İlgili Yazılar

Ustasından Flash dersleri

Soulblighter

Flash'la uğraşan ve ya ben bunu nasıl yaparım acaba diyenler için çok güzel bir site: gotoAndLearn.com

StarLogo artık OpenStarLogo

FZ

StarLogo ekibinden Eric Klopfer'in dünkü bir e-posta iletisine göre 8 Haziran 2006 itibariyle StarLogo artık OpenStarLogo adı altında kamuya açık kodlu olarak sunulmaktadır.

OpenStarLogo web sitesinde sistemin hem kaynak kod dosyalarını hem de derlenmiş hallerini bulmak mümkün. Böylece tüm dünyadaki programcı camiasının OpenStarLogo ve dolayısı ile StarLogo'ya katkıları kabul edilirken StarLogo ekibi de StarLogo TNG üzerindeki çalışmalarına odaklanmaya devam edecek.

İşletim Sistemleri Videoları

DemensMagnet

Birçok dağıtımın ve arada Vista'nın da videolarının bulunduğu http://osvids.com herkesin yer imlerinde bulunması gereken bir site. Bu yazı yazılırken SUSE Linux Enterprise Desktop 10 video arşivine eklenmişti.

Programlamanın Tao´su 5. ve 6. Kitap

FZ

5. Kitap - Bakım

Ve şöyle dedi usta programcı:

"Bir program üç satırı geçtiyse bir gün mutlaka bakıma ihtiyaç duyar."

PostScript Öğrenelim

misafir

PostScript'in nesini öğreneceğiz? O da JPEG ya da PNG gibi bir grafik dosyası formatı değil mi? Evet PostScript bir grafik dosyası formatı ama JPEG ve PNG'den çok farklı. Çünkü PostScript dosyaları aslında birer düz metin dosyası. Bunu görmek için hemen bir terminal açıp şu komutu verebilirsiniz: "cat dosya.ps". Gördüğünüz gibi bip bip sesleri duyulmadı ve anlamsız bir karakter dizisiyle karşılaşmadınız.