Bir programcı gözüyle DNA

0
tongucyumruk
"Eğer bir çekiçseniz, herşey bir çivi gibi gözükecektir".

Sanıyorum özellikle bu siteyi takip eden programcıların çoğu en az bir kez biyolojik yapılarla bilgisayarlar arasında bir bağlantı kurmaya çalışmıştır. Bu site DNA'dan başlayıp proteinlere uzanarak bilgisayar kavramları ile bu kavramların biyolojik karşılıkları konusunda oldukça detaylı bir inceleme içeriyor. Eğer kendini 4'lük sistemde (T, G, C, A) çalışan bir robot olarak ifade edenlerdenseniz bir uğramanızda fayda var.

Görüşler

0
FZ
Ben DNA mekanizmasını ve yol açtıklarını bir bilgisayar programına değil de daha çok GO oyununa benzetiyorum. Ya da tam tersi ;-)
0
malkocoglu
Shibumi'yi okudunuz galiba...
0
FZ
Allah seni inandırsın GO oyunu ile tanışıklığım SHIBUMI isimli kitabı okumamdan çok daha öncesine dayanıyor ve yani kişisel olarak alma ama bu soru ile 1500. kez karşılaşmak ruhumda kaotik fırtınalara yol açıyor :-P

Ne kitapmış yahu :) Bilmem kaç bin yıllık oyun için halkla ilişkiler kampanyası görevi gördü, kimsenin yapamadığını yaptı :)
0
FZ
Söz kitaplardan açılmışken GO bağlamında okuduğum en güzel romanlardan biri olan GO USTASI adlı kitabı tavsiye ederim.
0
polat
bir de dna kodlarini kullanarak mesaj yazma olayi var dna-o-gram diye..

gctaagaaaacaatgaaggtaatgaccatgaacaaggcaagcacg
0
anonim
Yakın bi gelecekte hdd'lerin yaptığı işi dna'lar üstlenebilir.
0
FZ
Bir de Adleman isimli üstad var, bizzat biyoloji laboratuvarındaki çözeltilerde barındırdığı genlerle optimizasyon problemlerini falan çözen. Kendisi meşhur (açık anahtar şifreleme algoriması) RSA´daki ´A´ oluyor ;-) Ya da DNA´nın A´sı mı deseydim? Yoksa ADENIN´in A´sı mı? :)
Görüş belirtmek için giriş yapın...

İlgili Yazılar

OpenGL 3 (Long Peak) Duyuruldu

Tarık

OpenGL Long Peak (OpenGL 3) 8 Ağustos 2007 tarihinde, San Diago'da yapılan "Siggraph Birds of a Feather (BOF)" toplantısında resmi olarak duyuruldu.

Kaynak: OpenGL

Python 2.4

tongucyumruk

18 aylık uzun bir bekleyişin ardından Python 2.4 çıktı. Yenilikler arasında özellikle dekoratörler, geliştirilmiş üreteç desteği ve long veri itipi ile integer veri tipinin birleştirilmesi göze çarpıyor. Özellikle MS Windows kullanıcılarını ilgilendiren bir diğer yenilik ise bu sürümden başlayarak Python'un MS Windows platformunda msi paketleri kullanılarak dağıtılacak olması. Yeni sürümdeki yeniliklerin bir özetini buradan okuyabilir, daha detaylı bilgiyi ise A. M. Kuchling'in dökümanından okuyabilirsiniz. Yeni sürümü indirmek içinse buraya

Maxima 5.9.2 Çıktı

FZ

Maxima'nın 5.9.2 sürümü çıktı.

Maxima, meşhur sembolik hesaplama yazılımı Macsyma'nın GPL lisansı ile dağıtılan bir benzeridir. Maxima ile polinomlar, matrisler, sonlu kümeler, integraller (belirlili, belirsiz), türevler, diferansiyel denklemler üzerinde işlemler yapmak, lineer cebir işlemlerini gerçekleştirmek, keyfi büyüklükte sayılar kullanmak ve her türlü fonksiyonun iki boyutlu ve üç boyutlu grafiklerini çizmek mümkündür.

Maxima çeşitli UNIX ve benzeri sistemlerde, MS Windows sistemlerde çalışmaktadır. MS Windows için kurulum programı da mevcuttur.

MenuetOS Türkçe

madanadam

MenuetOS 32 bit assembly ile yazılmış bir işletim sistemidir. Tek diskete network destekli, renkli , süper hızlı ve küçük bir işletim sistemini sığdırmışlar. Şu sıralar onu Türkçeleştirmeye çalışıyorum. İlgilenirseniz MenuetOS sayfası: http://www.menuetos.org, Türkçe yama http://www.geocities.com/madanadam

İlk önce MenuetOS'un son kararlı sürümü olan 0.76 yı indirmeniz, kurmanız ve sonra kernel.zip'i açıp üzerine yamayı ekleyip fasm 1.50+ ile derlemeniz gerekiyor.

Bir Türk Programcısı Sinirlenirse: CORSIS - Açık Kodlu Derlem Analiz Yazılımı

FZ

Stallman bir yazıcı sürücüsünün kapalı olması yüzünden çıldırıp işe girişmişti. Linus, okulda eğitim için kullandığı Sun Solaris işletim sistemini evde kullanamayacağını görünce Linux çekirdeğini yazmaya başlamıştı. Ian Murdock Linux kurmanın uzman olmayanlar için hiç de kolay olmayacağını fark edip Debian dağıtımını geliştirmeye başlamıştı. Bilgisayar tarihi sinirli programcıların başlarının çaresine bakarken çevreye de epey fayda sağlamalarının örnekleri ile dolu. Şimdi böyle bir örneğin haberini okuyacaksınız:

Çetin Sert, Almanya'da bilgisayarla dil işleme (NLP - Natural Language Processing) konusunda çalışan 23 yaşında genç bir araştırmacı. Sert, Mike Scott tarafından geliştirilmiş ve dil işleme bağlamında sık kullanılan bir yazılım olan Wordsmith'in kısıtlayıcı lisansını, ödenmesi gereken paraları ve bunu evindeki PC'de rahatça kullanamayacağını görüp bu konuda profesörlerinin uyarıları ile karşılaşınca...