Bir programcı gözüyle DNA

0
tongucyumruk
"Eğer bir çekiçseniz, herşey bir çivi gibi gözükecektir".

Sanıyorum özellikle bu siteyi takip eden programcıların çoğu en az bir kez biyolojik yapılarla bilgisayarlar arasında bir bağlantı kurmaya çalışmıştır. Bu site DNA'dan başlayıp proteinlere uzanarak bilgisayar kavramları ile bu kavramların biyolojik karşılıkları konusunda oldukça detaylı bir inceleme içeriyor. Eğer kendini 4'lük sistemde (T, G, C, A) çalışan bir robot olarak ifade edenlerdenseniz bir uğramanızda fayda var.

Görüşler

0
FZ
Ben DNA mekanizmasını ve yol açtıklarını bir bilgisayar programına değil de daha çok GO oyununa benzetiyorum. Ya da tam tersi ;-)
0
malkocoglu
Shibumi'yi okudunuz galiba...
0
FZ
Allah seni inandırsın GO oyunu ile tanışıklığım SHIBUMI isimli kitabı okumamdan çok daha öncesine dayanıyor ve yani kişisel olarak alma ama bu soru ile 1500. kez karşılaşmak ruhumda kaotik fırtınalara yol açıyor :-P

Ne kitapmış yahu :) Bilmem kaç bin yıllık oyun için halkla ilişkiler kampanyası görevi gördü, kimsenin yapamadığını yaptı :)
0
FZ
Söz kitaplardan açılmışken GO bağlamında okuduğum en güzel romanlardan biri olan GO USTASI adlı kitabı tavsiye ederim.
0
polat
bir de dna kodlarini kullanarak mesaj yazma olayi var dna-o-gram diye..

gctaagaaaacaatgaaggtaatgaccatgaacaaggcaagcacg
0
anonim
Yakın bi gelecekte hdd'lerin yaptığı işi dna'lar üstlenebilir.
0
FZ
Bir de Adleman isimli üstad var, bizzat biyoloji laboratuvarındaki çözeltilerde barındırdığı genlerle optimizasyon problemlerini falan çözen. Kendisi meşhur (açık anahtar şifreleme algoriması) RSA´daki ´A´ oluyor ;-) Ya da DNA´nın A´sı mı deseydim? Yoksa ADENIN´in A´sı mı? :)
Görüş belirtmek için giriş yapın...

İlgili Yazılar

EnderUNIX'den 11. yerli yazılım

honal

EnderUNIX VoIPong, bağlı olduğu ağda, bütün trafiği görebilen bir noktaya yerleştirildiğinde, o anda aktif olan bütün VoIP çağrılarını tespit edebilmekte ve G711 algoritması ile sıkıştırılmış olanları (örneğin Microsoft Netmeeting görüşmeleri) PC'lerin "de facto" ses dosyalama standardı WAVE dosya formatında (.wav) diske kaydedebilmektedir. Sonradan, bu görüşmeler standart bir ses ortam yürütücüsü (örneğin Linux play, Windows Media Player) ile açılıp dinlenebilmektedir.

IT uzmanlarının bilgilerini paylaşabilecekleri bir platform

anonim

Stackoverflow ya da experts-exchange gibi yurtdışı kaynakların ülkemizdeki eksikliği genelde forumlarla doldurulmaya çalışılıyor. Ancak çok daha genel amaçlı hazırlanmış olan forum yazılımları ihtiyaca tam cevap veremiyor.

Uzmansorusu.com, puanlama sistemi kullanarak bilgisini diğerleri ile paylaşan üyeleri önplana çıkartarak ödüllendiriyor, sosyal ağlardan alıştığımız "kullanıcı grupları" ile aynı ilgi alanlarını paylaşan kişilerin birbileri ile irtibat halinde olmasına olanak sağlıyor, arşivleme ve detaylı filtreleme özellikleri ile kişiye özgü "bilgi veritabanı" tutmalarını sağlıyor.

BIOS Logosunu Değiştirelim

FZ

Eğer siz de "bilgisayarı her açtığımda gördüğüm 'EnergyStar Logosu'ndan sıkıldım" diyenlerdenseniz, Gökhan "Crematorium" Olgun arkadaşımızın BIOS Logosunu Değiştirelim konu başlıklı yazısı ilginizi çekecektir.

Internet Explorer`ın Sağ Üst Köşesindeki Pencereden Kurtulun!

FZ

Eğer benim gibi bir Internet Explorer kullanıcısı iseniz ve sağ üst köşedeki dalgalı pencere sembolünden gına geldiyse, tepede Microsoft Internet Explorer yazısı görmek gözlerinizi yoruyorsa yapmanız gereken Edensoft'u ziyaret etmek ve MyLogo yazılımını çekmek. Gerisi sizin keyfinize kalmış.

Truva Linux 1.0 Beta Duyuruldu!

anonim

2004 yılı Nisan ayında bir grup Linux gönüllüsü tarafından Türk Linux kullanıcılarının ihtiyacına göre hızlı, güvenilir, kurulumu ve kullanımı kolay işletim sistemi hazırlanması amacıyla başlatılan Truva Linux Projesi'nin ilk ürünü "Helen" kod adlı "Truva Linux 1.0 Beta" sürümü duyuruldu.